Search Results

13 - 16 of 16 Products for 'Agile' Page 2 of 2 |

Agile

32311a coverSinglesRR.indd

32311a coverSinglesRR.indd

…February 2009 and 2004, respectively, until the purchase of Varian by Products Division at Xilinx. Mr. Vij joined Xilinx in 1996 as Director
Agilent Technologies, Inc. in May 2010. Mr. Rogerson served as of FPGA Marketing. He is a graduate of General Electric's Edison
Varian's Chief…

Coherent

Coherent


February 2009 and 2004, respectively, until the purchase of Varian by at Xilinx. Mr. Vij joined Xilinx in 1996 as Director of FPGA
Agilent Technologies, Inc. in May 2010. Mr. Rogerson served as Marketing. He is a graduate of General Electric's Edison Engineering
Varian's Chief…

Microsoft Word - Wavelength Control and Locking with Sub-MHz Precision

Microsoft Word - Wavelength Control and Locking with Sub-MHz Precision

…output wavelength with similar precision. The PZT actuator also enables rapid tuning over several GHz for applications that require wavelength agility. This feature is now standard on all Verdi-IR lasers and optional on all Verdi-green lasers (excluding the new Verdi G-Series), where it is also…

MerMAIDs: a family of metagenomically discovered marine anion-conducting and intensely desensitizing channelrhodopsins

MerMAIDs: a family of metagenomically discovered marine anion-conducting and intensely desensitizing channelrhodopsins

…was added as
start codon for MerMAID1 and MerMAID4. Site-directed mutagenesis of the
MerMAID1 gene was performed using Pfu polymerase (Agilent Technologies,
Santa Clara, CA) using the following oligonucleotides: GTGTCCGGCGTGCAG
TTCATC (E44Q_fwd), GATGAACTGCACGCCGGACAC (E44Q_rev),…